Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on the expression of transforming growth factor β (TGF-β)/SMAD pathway-related factors in induced membrane. a) The protein level of TGF-β1, phosphorylated SMAD (p-SMAD)2 and p-SMAD3 was detected by western blot. b) Immunohistochemistry result of TGF-β1, p-SMAD2 and p-SMAD3. N = 6/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01, ###p < 0.001 vs the L-Naringin group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Expressing, Membrane, Western Blot, Immunohistochemistry, Control

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: Characterization of endothelial progenitor cells (EPCs) and transfection efficacy of small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1). a) was the immunofluorescence result of cluster of differentiation (CD)34 and vascular endothelial growth factor receptor 2 (VEGFR2). b) EPCs could simultaneously absorb DiI-labelled acetylated low-density lipoprotein (Dil-Ac-LDL) and fluorescein isothiocyanate-labeled Ulex europaeus agglutinin I (FITC-UEA-I). Scale bar: 100 μm. c) Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. d) Western blot was used to validate the silencing effect of si-TGF-β1 #1, #2 and #3. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the si-TGF-β1 negative control (NC) group; ##p < 0.01, ###p < 0.001 vs the si-TGF-β1 #2 group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Transfection, Small Interfering RNA, Immunofluorescence, Labeling, Reverse Transcription, Polymerase Chain Reaction, Quantitative RT-PCR, Western Blot, Negative Control

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on the proliferation and viability of endothelial progenitor cells (EPCs). a) 5-ethynyl-2'-deoxyuridine (EdU) staining method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). Scale bar: 100 μm. N = 5/group. b) Cell Counting Kit-8 (CCK-8, Beyotime, China) method was used to detect the effect of naringin on the viability of EPCs at different stages (24, 48, and 72 hours). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, ** p< 0.01, ***p < 0.001 vs the control group; #p < 0.05, ##p < 0.01 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Staining, Cell Counting, CCK-8 Assay, Control, Small Interfering RNA

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on the migration, invasion and tube formation of endothelial progenitor cells (EPCs). a) Scratch wound was used to detect the invasion area of EPCs within 24 hours. Scale bar: 200 μm. b) Transwell assay was used to detect the number of migrated EPCs at 24 hours. Scale bar: 100 μm. c) The tube formation experiment detected the total tube length of EPCs. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). **p < 0.01, ***p < 0.001 vs the control group; ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Migration, Transwell Assay, Control, Small Interfering RNA

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: The effect of naringin on angiogenic-osteogenic and transforming growth factor β (TGF-β)/SMAD pathway-related factors of endothelial progenitor cells (EPCs). a) The concentrations of platelet derived growth factor BB (PDGF-BB), vascular endothelial growth factor (VEGF), and slit guidance ligand 3 (SLIT3) in the supernatant of EPCs were detected by enzyme-linked immunosorbent assay. b) Alizarin red staining (ARS) was performed to detect mineralized nodules in osteoblasts. Scale bar: 50 μm. c) The protein level of p-SMAD2 and p-SMAD3 in EPCs was detected by western blot. d) was the immunofluorescence result of p-SMAD2. Scale bar: 100 μm. N = 5/group. Each value was presented as the mean (SD). ***p < 0.001 vs the control group; ##p < 0.01, ###p < 0.001 vs the small interfering RNA targeting transforming growth factor-β1 (si-TGF-β1) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Derivative Assay, Enzyme-linked Immunosorbent Assay, Staining, Western Blot, Immunofluorescence, Control, Small Interfering RNA

Journal: Bone & Joint Research

Article Title: Naringin targets TGF-β1-mediated angiogenesis to enhance the osteogenic effect of induced membrane

doi: 10.1302/2046-3758.155.BJR-2025-0412.R1

Figure Lengend Snippet: Interactions between naringin and transforming growth factor-β1 (TGF-β1). a) The basic chemical structure of naringin. b) 3D and 2D molecular docking patterns of naringin with TGF-β1. c) to g) Results of molecular dynamics simulation analysis illustrating root mean square deviation (RMSD), root mean square fluctuation (RMSF), radius of gyration (Rg), solvent-accessible surface area (SASA), and hydrogen-bond number for the TGF-β1-naringin complexes. h) Representative images of cellular thermal shift assay (CETSA) showing TGF-β1 thermal stability after naringin treatment. i) CETSA curve was performed using GraphPad Prism (GraphPad Software, USA). N = 5/group. Each value was presented as the mean (SD). *p < 0.05, **p < 0.01, ***p < 0.001 vs the dimethyl sulfoxide (DMSO) group.

Article Snippet: Three small interfering RNA sequences targeting TGF-β1 (si-TGF-β1 #1, si-TGF-β1 #2, si-TGF-β1 #3) and a negative control sequence (si-TGF-β1 NC) were synthesized separately by Sangon Biotech (China).

Techniques: Solvent, Thermal Shift Assay, Software

Journal: Cell Reports Medicine

Article Title: Overcoming ADC resistance in advanced colorectal cancer by dual targeting of TROP2 and PERK to suppress Wnt/β-catenin signaling

doi: 10.1016/j.xcrm.2026.102769

Figure Lengend Snippet:

Article Snippet: ShPERK #2 targeted sequence: 5′- GTTGTGCTAGCAACCCTAATA -3′ , Sangon Biotech , N/A.

Techniques: Recombinant, Lysis, Cell Viability Assay, cDNA Synthesis, RNA sequencing, Sequencing, Plasmid Preparation, Software